RegulonDB RegulonDB 10.9: Gene Sequence
prmA gene sequence


Size: 882        A: 208  T: 195  G: 254  C: 225

Fasta

 

>prmA E. coli K12. Version NC_000913.3 GI:556503834
atgccttggatccaactgaaactgaacaccaccggcgcgaacgcggaagatcttagcgat
gcgctgatggaagcgggtgccgtttctatcacttttcaggatacccacgatacgccagta
tttgaaccgctgccgggcgaaacgcgcctgtggggcgacaccgatgtgattggtctgttc
gacgctgaaaccgatatgaacgacgtggtggcgattctggaaaaccatccgctgctcggc
gcaggcttcgcgcataaaatcgaacaactagaagataaagactgggagcgcgaatggatg
gataatttccacccgatgcgctttggtgaacgactgtggatctgccctagctggcgtgat
gtgccggacgaaaacgccgtcaacgtgatgttagatccagggctggcgtttggtacgggt
acccatccaaccacctctctgtgcctgcaatggctcgacagcctcgatttaaccggtaaa
acagtcatcgactttggctgtggttccggcattctggcgatcgcggcgctgaaactgggt
gcagcaaaagccattggtattgatatcgatccgcaggcgattcaggccagccgcgataac
gccgaacgtaatggcgtttctgaccgtctggaactctacttaccgaaagatcagccagaa
gaaatgaaagccgacgtggtggtcgctaacatccttgcaggcccattacgtgaactggca
ccgttaatcagcgtcctgccggtttcaggcggtttgctgggcctttccggtattctggca
agccaggcagagagcgtttgtgaagcttatgccgatagcttcgcactggacccggtcgtg
gaaaaagaagagtggtgccgtattaccggtcgtaagaattaa
              
                            

Download fasta file
RegulonDB