RegulonDB RegulonDB 10.9: Gene Sequence
yhdJ gene sequence


Size: 885        A: 263  T: 202  G: 208  C: 212

Fasta

 

>yhdJ E. coli K12. Version NC_000913.3 GI:556503834
atgagaacaggatgtgaaccgacccggtttggtaatgaagctaagaccattattcacggt
gatgcgcttgccgaacttaaaaagatccccgccgaaagtgtcgatctgatctttgccgac
ccaccatataacatcggtaaaaattttgatggtctgatcgaagcctggaaagaagatctg
tttatcgactggctgtttgaagtgattgcagagtgccaccgcgttctgaaaaagcagggc
agcatgtacatcatgaacagtacggaaaacatgccctttatcgatctccagtgccgcaag
ctttttaccatcaaaagtcgcatcgtctggtcatatgacagttctggagtgcaggcgaaa
aaacactacggctccatgtacgaacccatcctgatgatggtgaaagacgcaaagaactac
acattcaacggtgatgctattctggtagaagccaaaaccggatcgcagcgcgcgttgatc
gattatcgcaaaaatcctccacagccttacaatcatcaaaaagtaccgggtaacgtttgg
gattttccgcgcgtgcgttatttgatggatgaatatgaaaaccacccgacgcaaaaaccg
gaagccttactgaaacgcattattctcgcctcttccaacccaggcgatatcgttctcgac
ccgtttgctggtagctttactaccggtgccgtagccatcgccagcggacgaaaattcatt
ggtattgagatcaacagcgagtacatcaaaatggggcttcgacggctggatgtcgcgtcg
cattactctgcggaagaactggcgaaagtgaaaaaaagaaagaccggcaacctgtcaaaa
cgaagccggttaagcgaagttgaccccgatctcattacaaagtaa
              
                            

Download fasta file
RegulonDB