RegulonDB RegulonDB 10.9: Gene Sequence
yhbE gene sequence


Size: 966        A: 182  T: 272  G: 282  C: 230

Fasta

 

>yhbE E. coli K12. Version NC_000913.3 GI:556503834
atgaagcagcaggcaggcattggcattcttttggcgctcaccacagcaatttgctggggg
gcgttgccaatcgcaatgaagcaggtgctggaggtgatggaacctccgacaatcgtgttt
taccgtttcttgatggcgagtattggcctgggtgccattcttgcggtgaagaagaggttg
ccgccattacgcgtgtttcgtaagccacgctggttgattttgttggcagtggcgaccgcc
gggctgtttgggaacttcatcctgttcagctcatccttgcaatacctgagtccgaccgct
tcgcaggtgattgggcaactctcgccagttggcatgatggttgccagcgtatttatcctc
aaagagaaaatgcgcagcactcaggttgtaggggcattgatgctcctgagcggcctggtg
atgttttttaacaccagtctggtcgagatatttacaaagctcaccgattacacctgggga
gttatctttggggtcggtgcggcgacggtttgggtgagttatggcgtggcgcaaaaggtt
ttattgcgtcggctggcctcaccgcagatcctgtttttactgtacactttatgtacaatt
gcgctcttccctctggcaaagcctggagtgatagcgcagcttagccactggcagctcgca
tgtttaattttttgcggactgaataccttggtaggatatggcgccctggcggaagcgatg
gctcgctggcaggcagcgcaggtgagcgcgatcatcacgctcaccccactgtttacgctg
tttttttcagatcttttatcactggcctggcccgatttcttcgccagaccgatgttaaac
cttttaggttatctcggtgcgtttgtcgtggttgcgggcgcgatgtattccgccattggt
catcgtatttggggcggattacgtaagcatacaacggtggtatcgcaaccccgcgcaggc
gaatga
              
                            

Download fasta file
RegulonDB