RegulonDB RegulonDB 10.9: Gene Sequence
adiA gene sequence


Size: 2268        A: 566  T: 507  G: 569  C: 626

Fasta

 

>adiA E. coli K12. Version NC_000913.3 GI:556503834
atgaaagtattaattgttgaaagcgagtttctccatcaagacacctgggtcggtaacgcc
gttgagcgtctggcagatgctttaagccagcaaaatgttaccgtgattaaatccacctcc
tttgatgatggttttgccattctctcttcaaacgaagccattgactgcctgatgttcagc
tatcaaatggaacatccggacgaacatcaaaacgtcagacaattgatcggtaagcttcat
gagcgccaacaaaacgtgccggtcttcctgttgggcgatcgggaaaaagccctcgccgca
atggatcgcgacctgctggagcttgtcgatgaattcgcctggattctggaagataccgcc
gactttatcgccggacgcgccgttgccgcgatgacccgctaccgccagcagctgttgccg
ccactgttcagcgcgctgatgaaatatagtgacatccatgaatattcctgggcagcgcca
ggccaccagggcggcgttggttttaccaaaacacccgccggacgtttctaccatgactac
tatggtgaaaatctgttccgcaccgacatgggcatcgaacgaacttccctcggttctttg
cttgaccatactggcgcatttggcgaaagcgaaaaatatgccgcacgcgtatttggtgcc
gatcgctcctggtcggtagtcgtcggtacttccggctctaaccgcaccatcatgcaggct
tgcatgaccgataacgatgtcgtggtcgttgaccgtaactgccataaatccatcgaacaa
ggtttgatgctgacaggcgcgaaaccggtctatatggtgccaagccgcaaccgctacggc
attatcgggccaatctatccgcaggaaatgcaacctgaaaccttgcagaagaaaatcagt
gaaagcccgctgaccaaagacaaagccgggcaaaaaccgtcttactgcgtggtgaccaac
tgcacctatgacggcgtgtgttataacgctaaagaagcgcaggatctgctggaaaaaacc
tccgatcgtctgcactttgacgaagcctggtacggctatgcacgtttcaacccgatctat
gccgatcactatgccatgcgcggcgaacctggcgatcacaacggtcctaccgttttcgcc
acccactccacccacaaactgctgaatgcgctgtcacaggcttcttatattcatgtacgt
gaaggtcgtggggcgattaacttctcccgcttcaaccaggcctacatgatgcatgccacc
acctccccgctgtatgccatctgcgcatccaacgacgtggcggtgtcgatgatggacggc
aacagcggcctgtcactgacacaggaagtgattgacgaagcggttgatttccgtcaggcg
atggcgcggctatataaagagttcaccgctgacggtagctggttcttcaaaccgtggaac
aaagaagtcgtcaccgacccacaaaccggcaaaacctatgactttgctgacgcaccaacc
aaactgctgaccaccgttcaggactgctgggtaatgcatccgggcgaaagctggcacggc
ttcaaagatattccggataactggagtatgctcgacccgattaaagtcagcatccttgct
ccgggaatgggtgaagatggtgaactggaagaaaccggtgttccggcggcgctggtcact
gcctggcttggtcgccacggcattgtacctacccgcaccactgacttccaaattatgttc
ctgttctctatgggcgtaacccgtgggaaatggggaactctggttaacaccctttgctcc
ttcaaacgccactatgacgccaacacaccgctggcgcaggtgatgccggaacttgttgaa
caatatcctgacacttacgcgaacatggggattcacgatctgggtgacaccatgtttgcc
tggctgaaagaaaacaaccctggcgcacggttgaacgaagcctattccggcctgccggtg
gcggaagtcaccccgcgtgaagcgtacaacgcgattgtcgacaacaatgtcgaactggta
tccattgaaaatctgccaggacgcatcgcggcaaactcagttatcccgtatccgccagga
atcccgatgctgctgtctggtgaaaacttcggcgataaaaacagtccgcaagtaagttat
ttacgctcgctgcaatcctgggaccaccatttccctggatttgaacacgaaactgaaggg
actgaaattattgacggtatttaccacgttatgtgcgtgaaagcgtaa
              
                            

Download fasta file
RegulonDB