RegulonDB RegulonDB 10.9: Gene Sequence
rcsF gene sequence


Size: 405        A: 103  T: 86  G: 98  C: 118

Fasta

 

>rcsF E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgctttaccgatctgtttagtagcactcatgctaagcggctgttccatgttaagc
agatcccctgtcgaacccgttcaaagcactgcaccccagccgaaagcggagcctgcaaaa
ccgaaagcgccgcgcgccacgccggtccgaatttataccaatgcagaagaattagtcggc
aaaccgttccgcgatctcggtgaagtcagtggcgactcttgccaggcctctaatcaggac
tctccgccgagcattccaaccgcacgtaagcggatgcaaatcaacgcctctaaaatgaaa
gccaatgctgtattactgcatagctgcgaagtcaccagcggtacgccaggctgctatcgt
caggctgtatgtatcggttctgcgcttaacattacggcgaaatga
              
                            

Download fasta file
RegulonDB