RegulonDB RegulonDB 10.9: Gene Sequence
metQ gene sequence


Size: 816        A: 234  T: 181  G: 210  C: 191

Fasta

 

>metQ E. coli K12. Version NC_000913.3 GI:556503834
atggcgttcaaattcaaaacctttgcggcagtgggagccctgatcggatcactggcactg
gtaggctgcggtcaggatgaaaaagatccaaaccacattaaagtcggcgtgattgttggt
gccgaacagcaggttgcagaagtcgcgcagaaagttgcgaaagacaaatatggcctggac
gttgagctggtaaccttcaacgactatgttctgccaaacgaagcattgagcaaaggcgat
atcgacgccaacgccttccagcataaaccgtaccttgatcagcaactgaaagatcgtggc
tacaaactggtcgcagtaggcaacacttttgtttatccgattgctggttactccaagaaa
atcaaatcactggatgaactgcaggatggttcgcaggttgccgtgccaaacgacccaact
aaccttggtcgttcactgctgctgctgcaaaaagtgggcttgatcaaactgaaagatggc
gttggcctgctgccgaccgttcttgatgttgttgagaaccccaaaaatctgaaaattgtt
gaactggaagcaccgcaactgccgcgttctctggacgacgcgcaaatcgctctggcagtt
atcaataccacctatgccagccagattggcctgactccggcgaaagacggtatctttgtt
gaagataaagagtccccgtacgtaaacctgatcgtgacgcgtgaagataacaaagacgcc
gagaacgtgaagaaattcgtccaggcttatcagtctgacgaagtttacgaagcagcaaac
aaagtgtttaacggcggagctgttaaaggctggtaa
              
                            

Download fasta file
RegulonDB