RegulonDB RegulonDB 10.9: Gene Sequence
holE gene sequence


Size: 231        A: 62  T: 57  G: 62  C: 50

Fasta

 

>holE E. coli K12. Version NC_000913.3 GI:556503834
atgctgaagaatctggctaaactggatcaaacagaaatggataaagtgaatgtcgatttg
gcggcggccggggtggcatttaaagaacgctacaatatgccggtgatcgctgaagcggtt
gaacgtgaacagcctgaacatttgcgcagctggtttcgcgagcggcttattgcccaccgt
ttggcttcggtcaatctgtcacgtttaccttacgagcccaaacttaaataa
              
                            

Download fasta file
RegulonDB