RegulonDB RegulonDB 10.9: Gene Sequence
mbiA gene sequence


Size: 486        A: 110  T: 142  G: 107  C: 127

Fasta

 

>mbiA E. coli K12. Version NC_000913.3 GI:556503834
atgcgggtcagttggctggaaagcaaatgcgacacaccttttgccaataatttgtctttc
atcagcagcggcagcagctcttccagctcattcaccctggcatcgaccgcgtgcagaaac
tcctgcttatgttcctcgtccattttcttccaggtattacgcagaaattgttccagtaac
tgttgctcaatttcaaacgtagacatctctttgtcggctttcagcttcaatcgctttgaa
acatcgagcaaaatggcccgatacaatttaccgtgtccgcgcagtttgttggcgatacta
tcgccaccaaaatgctgtaattctccggcaatcagctgccagttgcggcgatgttgctcg
ggatgcccttccatcgatttaaacagttcgttgcgcatcagtacgctggagaggcgagtt
ttgcctttttcattatgggtgagcaatcgggcgaaatttgccaactgttcctcactacaa
tgctga
              
                            

Download fasta file
RegulonDB