RegulonDB RegulonDB 10.9: Gene Sequence
ppk gene sequence


Size: 2067        A: 528  T: 529  G: 494  C: 516

Fasta

 

>ppk E. coli K12. Version NC_000913.3 GI:556503834
atgggtcaggaaaagctatacatcgaaaaagagctcagttggttatcgttcaatgaacgc
gtgcttcaggaagcggcggacaaatctaacccgctgattgaaaggatgcgtttcctgggg
atctattccaataaccttgatgagttctataaagtccgcttcgctgaactgaagcgacgc
atcattattagcgaagaacaaggctccaactctcattcccgccatttactgggcaaaatt
cagtcccgggtgctgaaagccgatcaggaattcgacggcctctacaacgagctattgctg
gagatggcgcgcaaccagatcttcctgattaatgaacgccagctctccgtcaatcaacaa
aactggctgcgtcattattttaagcagtatctgcgtcagcacattacgccgattttaatc
aatcctgacactgacttagtgcagttcctgaaagatgattacacctatctggcggtggaa
attatccgtggcgataccatccgttacgcgctgctggagatcccatcagataaagtgccg
cgctttgtgaatttaccgccagaagcgccgcgtcgacgcaagccgatgattcttctggat
aacattctgcgttactgccttgatgatattttcaaaggcttctttgattatgacgcgctg
aatgcctattcaatgaagatgacccgcgatgccgaatacgatttagtgcatgagatggaa
gccagcctgatggagttgatgtcttccagtctcaagcagcgtttaactgctgagccggtg
cgttttgtttatcagcgcgatatgcccaatgcgctggttgaagtgttacgcgaaaaactg
actatttcccgctacgactccatcgtccccggcggtcgttatcataattttaaagacttt
attaatttccccaatgtcggcaaagccaatctggtgaacaaaccactgccgcgtttacgc
catatttggtttgataaagcccagttccgcaatggttttgatgccattcgcgaacgcgat
gtgttgctctattatccttatcacacctttgagcatgtgctggaactgctgcgtcaggct
tcgttcgacccgagcgtactggcgattaaaattaacatttaccgcgtggcgaaagattca
cgcatcatcgactcgatgatccacgccgcacataacggtaagaaagtcaccgtggtggtt
gagttacaggcgcgtttcgacgaagaagccaacattcactgggcgaagcgcctgaccgaa
gcaggcgtgcacgttatcttctctgcgccggggctgaaaattcacgccaaactgttcctg
atttcacgtaaagaaaacggtgaagtggtgcgttatgcacacatcgggaccgggaacttt
aacgaaaaaaccgcgcgtctttatactgactattcgttgctgaccgccgatgcgcgcatc
accaacgaagtacggcgggtatttaactttattgaaaacccataccgtccggtgacattt
gattatttaatggtatcgccgcaaaactcccgccgcctattgtatgaaatggtggaccgc
gagatcgccaacgcgcagcaagggctgcccagtggtatcaccctgaagctaaataacctt
gtcgataaaggcctggttgatcgtctgtatgcggcctccagctccggcgtaccggttaat
ctgctggttcgcggaatgtgttcgctgatccccaatctggaaggcattagcgacaacatt
cgtgccatcagtattgttgaccgttaccttgaacatgaccgggtttatatttttgaaaat
ggcggcgataaaaaggtctacctttcttccgccgactggatgacgcgcaatattgattat
cgtattgaagtggcgacgccgctgctcgatccgcgcctgaagcagcgggtactggacatc
atcgacatattgttcagcgatacggtcaaagcacgttatatcgataaagaactcagtaat
cgctacgttccccgcggcaatcgccgcaaagtacgggcgcagttggcgatttatgactac
atcaaatcactcgaacaacctgaataa
              
                            

Download fasta file
RegulonDB