RegulonDB RegulonDB 10.9: Gene Sequence
satP gene sequence


Size: 567        A: 103  T: 163  G: 154  C: 147

Fasta

 

>satP E. coli K12. Version NC_000913.3 GI:556503834
atgggcaacactaagttggctaatccggcaccgctgggcctgatgggcttcggcatgacc
accattctgcttaacctgcacaacgtgggttatttcgctctggacggtattattcttgcc
atgggcattttctacggcggcatcgcgcaaatttttgctggtctgctggagtacaaaaaa
ggcaacactttcggtttaaccgcattcacctcttacggttctttctggctgacgctggtt
gcgattctgctgatgccgaaactgggtctgaccgatgcgccaaatgcacagttccttggt
gtctacctgggtctgtggggcgtatttacgctgtttatgttcttcggcacgctgaaaggc
gcacgcgttctgcaattcgttttctttagcctgaccgtgctgtttgccctgctggcgatc
ggtaacattgccggtaacgccgcaatcatccactttgccggctggattgggctgatctgc
ggtgccagcgcaatctatctggcgatgggtgaagtactgaacgagcagtttggtcgcacc
gttctgccgattggtgaatcccactaa
              
                            

Download fasta file
RegulonDB