RegulonDB RegulonDB 10.9: Gene Sequence
gltF gene sequence


Size: 765        A: 223  T: 195  G: 169  C: 178

Fasta

 

>gltF E. coli K12. Version NC_000913.3 GI:556503834
atgtttttcaaaaagaacctcacaacagctgctatttgtgcagcactttctgttgcagca
ttcagtgccatggcaacagattcaactgatacagaattaactatcatcggcgagtatacc
cctggtgcatgtaccccagttgttacgggcggcggcattgttgactatgggaaacatcat
aacagtgcgctgaatccgaccggtaaaagtaataaactggttcaactgggccgcaaaaac
agcacattaaatataacctgcacagcaccaacgctaattgctgtaacctccaaggataac
cgtcagtcgaccattgtagcgttaaacgacacatcctatattgaaaaagcttatgatact
ctcgtagatatgaagggaacgaaaaacgcctttggtttaggttctgcgcctaatggacaa
aaaattggcgctgcatccattggtattgacaggtctaatggtgggattcacgcggcggac
gatacaggtgaaattcctgtcgacctgattcaaactgaccactggtcagcagcgaccccc
acatggaaagcctcatctaatggcgcattctgctcgctgacaagttgctcagcaatcgag
cgcggttattctgttgcaaaaacaggggaactgacacctgttgctattacagcggtcacc
ttcccgttactgattgatgctgcggtaaatgacaatactattcttggttctgatgaaacg
atcaaactggatggtaacgtcactatcagcgttcagtatttataa
              
                            

Download fasta file
RegulonDB