RegulonDB RegulonDB 10.9: Gene Sequence
yhcA gene sequence


Size: 675        A: 215  T: 179  G: 130  C: 151

Fasta

 

>yhcA E. coli K12. Version NC_000913.3 GI:556503834
atgctcagacacattacattcactgtatttataacaacatcaatgaataccttagccaca
gggatggttcctgaaacatcagtattgctggttgatgaaaagcgtggtgaagctagtatt
aatattaagaatacagatgatcatccttcattgctttacaccaccattgttgatttgcct
gaaagcaataaatcaattcgtttaatcccgactcagcccgttattcgtgttgaagccggt
caagtacaacaggttcgatttttacttcaggcgactgttcctctgcaatcagaagagctg
aaacgcgtaacgttcgaaggtattccaccaaaagatgacaagagcagcagagttactgtt
tcaattcgtcaggatctacctgtactgatccacccggcttccctgccggaagagcgagag
acctggaaattcctggaatggcgtaaaaatggcgaccaaattgagattagcaaccccagt
aattatgtcgttcgtatgaccttacaatttaaaacgctcccttcaggaaaaacgggggct
ataaataagacctattttctaccacacaccagtacaactactgcattaacaaacgctacg
gatacaaaagtcgagttttacccagccagccgatatggttatcgcggtaataaatatgtc
actgacttaaaataa
              
                            

Download fasta file
RegulonDB