RegulonDB RegulonDB 10.9: Gene Sequence
ycgB gene sequence


Size: 1533        A: 409  T: 360  G: 396  C: 368

Fasta

 

>ycgB E. coli K12. Version NC_000913.3 GI:556503834
atggcgacgatcgattctatgaataaggacaccacacgtttgagcgatggacccgactgg
acgttcgacctgctggatgtttatctggcagagatagaccgggtggcgaaactctaccgg
ctggatacctacccgcaccagattgaagtgataacctcagaacagatgatggatgcctac
tccagcgtcggcatgccaattaactatccgcactggtcattcggtaaaaagtttatcgag
actgaacggctgtataagcacggtcagcaaggactggcctatgaaatcgtcattaactct
aacccgtgtatcgcttacctgatggaagagaacaccattaccatgcaagcgctggtgatg
gctcatgcctgctatgggcataactctttcttcaaaaacaattacttattccgtagctgg
accgacgccagttcgattgtcgattatctgatttttgcccgtaaatatattaccgagtgc
gaagagcgttatggcgttgatgaagtagaacggcttctggactcgtgccacgcgctgatg
aactacggcgtggaccggtacaaacgcccgcaaaaaatctcgctgcaagaagagaaagcc
cggcagaaaagtcgcgaagagtatctgcaaagtcaggtcaatatgctctggcgtaccctg
ccgaagcgcgaggaagagaaaacggttgctgaagcgcgccgctatccgtccgaaccacaa
gaaaacctgctctattttatggagaaaaatgcgccactgctggaatcatggcagcgtgaa
atcctgcgtattgtgcgtaaggtgagccagtatttttatccgcaaaaacagactcaggtg
atgaacgaaggctgggcgaccttctggcactacaccatccttaaccatctgtatgatgaa
gggaaagtaacggaacgttttatgctggagtttttgcacagccacaccaatgtggtcttc
cagcccccctataacagcccgtggtacagcggcatcaacccgtatgccctcgggttcgcc
atgttccaggatattaaacggatttgtcagtcgccaacggaagaagacaaatactggttc
ccggatatcgccggttccgactggctggaaacgctgcatttcgcgatgcgtgatttcaaa
gatgagagttttatcagccagttcctgtcaccgaaagtgatgcgtgatttccgcttcttc
accgtgctggatgacgatcggcataattatctggagatttccgctattcataatgaagaa
ggttatcgggagatccgtaaccggttatcgtcgcaatataacttaagtaatctggagccg
aatattcagatctggaacgtggatttgcgcggcgaccgttcgctgacgctgcgttatatt
ccacataatcgcgcaccgctggatcgggggcgcaaagaagtcctgaagcatgtgcatcgc
ctgtggggatttgatgtgatgctcgaacagcaaaacgaagacggcagcatcgagttgctg
gaacgttgcccgccaagaatgggaaatctgtaa
              
                            

Download fasta file
RegulonDB