RegulonDB RegulonDB 11.0: Gene Sequence
nikR gene sequence


Size: 402        A: 92  T: 80  G: 111  C: 119

Fasta

 

>nikR E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgagtcaccatcacgcttgatgacgatttactggagacgctggacagcctgagc
cagcgtcgtggttataacaaccgttccgaagctatccgcgacattctgcgtagcgccctg
gcgcaagaggccacccagcagcacggcacgcaaggtttcgcggtgctgtcgtatgtgtat
gaacacgaaaaacgcgacttagccagccgcattgtctccacccagcatcatcaccacgac
ctctccgtcgccacgctgcatgtgcacatcaaccacgacgactgtctggaaatcgccgtg
ttgaaaggtgacatgggtgacgtgcagcattttgccgatgacgttatcgcccagcgcggc
gtgcggcacgggcatttgcagtgcttgccgaaggaagattga
              
                            

Download fasta file
RegulonDB