RegulonDB RegulonDB 10.10: Gene Sequence
ybfA gene sequence


Size: 207        A: 45  T: 58  G: 54  C: 50

Fasta

 

>ybfA E. coli K12. Version NC_000913.3 GI:556503834
atggaactctacagagaatatcctgcatggcttatctttttacgccgtacttatgcggtt
gcagcgggcgttctggcgctgcctttcatgcttttctggaaagaccgcgcccgcttttac
agctacctgcatcgcgtctggtcgaaaaccagcgataaaccggtgtggatggatcaggcc
gaaaaggcaactggtgatttttattga
              
                            

Download fasta file
RegulonDB