RegulonDB RegulonDB 10.8: Gene Sequence
ybfC gene sequence


Size: 570        A: 193  T: 168  G: 122  C: 87

Fasta

 

>ybfC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagagttttgttctttttgctgatgatatttgttagttttggtgttatagctgat
tgcgaaatacaagctaaagatcatgattgttttactattttcgctaagggtactattttt
tccgcgtttcctgtcttaaataataaagccatgtggagatggtatcagaatgaggacatc
ggtgagtattattggcaaacagaactgggtacatgtaaaaataataaattcacaccaagc
ggggcgagactcttaattcgcgtcgggtcactacgccttaatgaaaatcatgccatcaaa
ggaacgttgcaggagttgataaatacagcagaaaaaacggcgtttctcggcgatcggttt
agaagttatataagagcgggtatctatcaaaaaaagagcagtgatccagttcagttgttg
gcagtccttgataattcaatcatggtaaaatattttaaagatgagaaaccaacttatgct
cgaatgacagcacatctcccgaacaaaaatgagtcttacgaatgtttaataaagatacag
catgaactaattcgtagtgaagagaaataa
              
                            

Download fasta file
RegulonDB