RegulonDB RegulonDB 10.9: Gene Sequence
ydcC gene sequence


Size: 1137        A: 369  T: 293  G: 275  C: 200

Fasta

 

>ydcC E. coli K12. Version NC_000913.3 GI:556503834
atggaacttaaaaaattgatgggacatatttctattatccccgattacagacaagcctgg
aaaatggaacataagttatcggatattctactgttgactatttgtgccgttatttctggt
gcagaaggctgggaagatatagaggattttggggaaacacatcccgattttttgaagcaa
tatggtgattttgaaaatggtattcctgttcacgacaccattgccagagttgtatcctgt
atcagtcctgcaaaatttcacgagtgctttattaactggatgcgtgactgccattcttca
gatgataaagacgtcattgcaattgatggaaaaacgctccggcattcttatgataagagt
cgccgcaggggagcgattcatgtcattagtgcgttctcaacaatgcacagtctggtcatc
ggacagatcaagacggatgagaaatctaatgagattacagctatcccagaacttcttaac
atgctggatattaaaggaaaaatcatcacaactgatgcgatgggttgccagaaagatatt
gcagagaagatacaaaaacagggaggtgattatttattcgcggtaaaaggaaaccagggg
cggctaaataaagcctttgaggaaaaatttccgctgaaagaattaaataatccagcgcat
gacagttacgcaatgagtgaaaagagtcacggcagagaagaaatccgtcttcatattgtt
tgcgatgtccctgatgaacttattgatttcacgtttgaatggaaagggctgaagaaatta
tgcgtggcagtctcctttcggtccataatagcagaacaaaagaaagagctcgaaatgacg
gtcagatattatatcagttctgctgatttaaccgcagagaagttcgccacagcaatccga
aaccactggcatgtggagaataagctgcactggcgtctggacgtggtaatgaatgaagac
gactgcaaaataagaagaggaaatgcagcagaattattttcagggatacggcacattgct
attaatattttgacgaatgataaggtattcaaggcagggttaagacgtaagatgcgaaaa
gcagccatggacagaaactacctggcgtcagtccttacggggagcgggctttcgtaa
              
                            

Download fasta file
RegulonDB