RegulonDB RegulonDB 11.0: Gene Sequence
fabI gene sequence


Size: 789        A: 171  T: 198  G: 208  C: 212

Fasta

 

>fabI E. coli K12. Version NC_000913.3 GI:556503834
atgggttttctttccggtaagcgcattctggtaaccggtgttgccagcaaactatccatc
gcctacggtatcgctcaggcgatgcaccgcgaaggagctgaactggcattcacctaccag
aacgacaaactgaaaggccgcgtagaagaatttgccgctcaattgggttctgacatcgtt
ctgcagtgcgatgttgcagaagatgccagcatcgacaccatgttcgctgaactggggaaa
gtttggccgaaatttgacggtttcgtacactctattggttttgcacctggcgatcagctg
gatggtgactatgttaacgccgttacccgtgaaggcttcaaaattgcccacgacatcagc
tcctacagcttcgttgcaatggcaaaagcttgccgctccatgctgaatccgggttctgcc
ctgctgaccctttcctaccttggcgctgagcgcgctatcccgaactacaacgttatgggt
ctggcaaaagcgtctctggaagcgaacgtgcgctatatggcgaacgcgatgggtccggaa
ggtgtgcgtgttaacgccatctctgctggtccgatccgtactctggcggcctccggtatc
aaagacttccgcaaaatgctggctcattgcgaagccgttaccccgattcgccgtaccgtt
actattgaagatgtgggtaactctgcggcattcctgtgctccgatctctctgccggtatc
tccggtgaagtggtccacgttgacggcggtttcagcattgctgcaatgaacgaactcgaa
ctgaaataa
              
                            

Download fasta file
RegulonDB