RegulonDB RegulonDB 10.10: Gene Sequence
ychH gene sequence


Size: 279        A: 56  T: 75  G: 83  C: 65

Fasta

 

>ychH E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgcaaaaacgcttcgttactcggtaacgtgctcatggggttgggtctggtggta
atggtggtcggcgtggggtattcaatcctcaaccagttaccacagtttaatatgccccag
tatttcgcacatggtgcagtgctaagtattttcgtcggtgccattctctggctggcgggt
gcccgtgttggcgggcatgaacaggtgtgcgaccgttactggtgggttcgccactatgac
aaacgttgccgccgtagcgataatcgccgtcatagctaa
              
                            

Download fasta file
RegulonDB