RegulonDB RegulonDB 10.9: Gene Sequence
yidE gene sequence


Size: 1662        A: 326  T: 457  G: 478  C: 401

Fasta

 

>yidE E. coli K12. Version NC_000913.3 GI:556503834
atgagtgatatagcattaacggtcagtattctggctttggtggcagtcgtcggtttgttt
atcggcaacgtcaaatttcgcggcataggattaggtattggcggcgtgctgtttggtggg
atcatcgtcggccattttgtttctcaggcggggatgacattaagtagcgatatgctgcat
gttattcaggaatttggcctgatcctgttcgtttatactatcgggattcaggtagggccg
ggcttctttgcctcattgcgcgtctccggattacgcctcaacctgtttgctgttctgatc
gtcatcatcggtggtctggttaccgccatcctgcataaactgtttgatattccactgccg
gtagtgctggggattttctccggtgcggttaccaatacgccagcgctgggggcagggcag
cagattttgcgcgacctgggtacaccaatggaaatggtcgatcagatggggatgagttac
gcgatggcgtatccattcggcatttgcgggattttgttcaccatgtggatgttgcgggtt
attttccgcgtcaatgtcgagacagaagctcagcagcacgagtcttcacgcaccaatggc
ggcgcgctgatcaagactatcaatattcgcgttgagaaccctaacctgcatgatttagcc
attaaagatgtaccgattctcaacggcgacaaaattatctgctcgcgtctgaaacgcgaa
gaaaccctaaaagttccttcgccagataccattatccaactgggcgatttgctgcatctg
gtgggtcagccagcggatttacataatgcgcaactggtgattggtcaggaggtcgatact
tcgctgtccacgaaaggcactgatttgcgcgtcgagcgtgtggtggtcaccaatgaaaac
gtgctcggaaaacgtattcgcgacctgcactttaaagaacgctatgacgttgttatctcg
cgcctgaaccgtgccggggtcgaactggtcgccagtggcgatatcagcctgcagttcggc
gatatcctcaatctggtggggcgtccgtccgcaattgatgccgttgccaatgtgctgggg
aatgcgcagcaaaaactgcaacaggttcagatgctgccagtgtttattggcatcgggcta
ggcgtattgttaggttctattcccgtctttgtgccaggattcccggccgcgttgaaactg
gggctggcgggcggaccgctgattatggcgttgatcctcgggcgtatcggcagtatcggc
aagctgtactggtttatgccgccaagcgccaacctcgcgctgcgggagctggggatcgtg
ctgttcctctcggtcgttggtctgaaatctggtggggattttgtgaataccctggtcaat
ggcgaagggctaagctggattggttatggtgccctgatcaccgccgttccgctgattact
gttggcattctggcgcggatgttagccaaaatgaattacctgaccatgtgcgggatgctg
gcaggttccatgaccgatcctccggcgctggcgtttgctaataatcttcatccaaccagc
ggtgcggcggcgctctcttacgccactgtctatccgttggtaatgttcctgcgcattatc
accccccaattactggcggtgctcttctggagtatcggttaa
              
                            

Download fasta file
RegulonDB