RegulonDB RegulonDB 11.0: Gene Sequence
pyrH gene sequence


Size: 726        A: 177  T: 166  G: 214  C: 169

Fasta

 

>pyrH E. coli K12. Version NC_000913.3 GI:556503834
atggctaccaatgcaaaacccgtctataaacgcattctgcttaagttgagtggcgaagct
ctgcagggcactgaaggcttcggtattgatgcaagcatactggatcgtatggctcaggaa
atcaaagaactggttgaactgggtattcaggttggtgtggtgattggtgggggtaacctg
ttccgtggcgctggtctggcgaaagcgggtatgaaccgcgttgtgggcgaccacatgggg
atgctggcgaccgtaatgaacggcctggcaatgcgtgatgcactgcaccgcgcctatgtg
aacgctcgtctgatgtccgctattccattgaatggcgtgtgcgacagctacagctgggca
gaagctatcagcctgttgcgcaacaaccgtgtggtgatcctctccgccggtacaggtaac
ccgttctttaccaccgactcagcagcttgcctgcgtggtatcgaaattgaagccgatgtg
gtgctgaaagcaaccaaagttgacggcgtgtttaccgctgatccggcgaaagatccaacc
gcaaccatgtacgagcaactgacttacagcgaagtgctggaaaaagagctgaaagtcatg
gacctggcggccttcacgctggctcgtgaccataaattaccgattcgtgttttcaatatg
aacaaaccgggtgcgctgcgccgtgtggtaatgggtgaaaaagaagggactttaatcacg
gaataa
              
                            

Download fasta file
RegulonDB