RegulonDB RegulonDB 10.9: Gene Sequence
tesA gene sequence


Size: 627        A: 142  T: 154  G: 162  C: 169

Fasta

 

>tesA E. coli K12. Version NC_000913.3 GI:556503834
atgatgaacttcaacaatgttttccgctggcatttgcccttcctgttcctggtcctgtta
accttccgtgccgccgcagcggacacgttattgattctgggtgatagcctgagcgccggg
tatcgaatgtctgccagcgcggcctggcctgccttgttgaatgataagtggcagagtaaa
acgtcggtagttaatgccagcatcagcggcgacacctcgcaacaaggactggcgcgcctt
ccggctctgctgaaacagcatcagccgcgttgggtgctggttgaactgggcggcaatgac
ggtttgcgtggttttcagccacagcaaaccgagcaaacgctgcgccagattttgcaggat
gtcaaagccgccaacgctgaaccattgttaatgcaaatacgtctgcctgcaaactatggt
cgccgttataatgaagcctttagcgccatttaccccaaactcgccaaagagtttgatgtt
ccgctgctgcccttttttatggaagaggtctacctcaagccacaatggatgcaggatgac
ggtattcatcccaaccgcgacgcccagccgtttattgccgactggatggcgaagcagttg
cagcctttagtaaatcatgactcataa
              
                            

Download fasta file
RegulonDB