RegulonDB RegulonDB 10.9: Gene Sequence
flgL gene sequence


Size: 954        A: 268  T: 202  G: 254  C: 230

Fasta

 

>flgL E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttcagtacacagatgatgtaccagcaaaacatgcgtggtatcaccaattctcag
gcagaatggatgaagtacggcgaacagatgtcgacgggtaagcgagtcgttaacccttct
gacgatcccattgctgcatcacaagccgtagttctctcccaggcacaggcgcaaaacagc
cagtacacgctggcgcgtactttcgccactcaaaaagtgtcactggaagagagtgtactt
agccaggtcaccactgctatccagaatgctcaggaaaaaattgtctacgccagcaatggc
accttgagtgacgatgaccgggcctcgctggctacggatattcaggggcttcgtgaccag
ttgctgaatctggcaaacaccactgacggtaacgggcgctacatttttgccggttataaa
acagagactgcgccgtttagcgaagagaaagggaaatacgtcggtggagcagaaagtatt
aaacaacaggtcgatgcttcgcgttcgatggtgatagggcacacgggtgacaaaattttc
gacagtattaccagcaacgcggtagcggaaccagacggtagcgcttctgaaaccaatctt
tttgccatgctggatagtgccatcgcagccctgaaaacgccggtcgcggatagcgaagcg
gataaagaaaccgccgctgcggcgttagataaaaccaaccgcggactgaaaaactcgctg
aacaatgtgctgactgttcgcgcggaattaggcacgcagctgaacgaactggagtcgctg
gattcattaggtagcgatcgcgctttagggcaaacgcagcagatgagcgatctggttgat
gtggactggaatgcaactatttcatcttacatcatgcagcaaacggcattgcaggcatcg
tataaagcatttaccgatatgcagggattgtcgctcttccagctcagcaaataa
              
                            

Download fasta file
RegulonDB