RegulonDB RegulonDB 10.9: Gene Sequence
nadC gene sequence


Size: 894        A: 226  T: 193  G: 236  C: 239

Fasta

 

>nadC E. coli K12. Version NC_000913.3 GI:556503834
atgccgcctcgccgctataaccctgacacccgacgtgacgagctgctggaacgcattaat
ctcgatatccccggcgcggtggcccaggcgctgcgggaagatttaggcggaacagtcgat
gccaacaatgatattacggcaaaacttttaccggaaaattctcgctctcatgccacggtg
atcacccgcgagaatggcgtcttttgcggcaaacgctgggttgaagaggtgtttattcaa
ctggcaggcgacgatgtcaccataatctggcatgtggatgacggcgatgtcatcaatgcc
aatcaatccttgttcgaacttgaaggcccatcccgcgtgctgttaacgggcgaacgcact
gcgcttaattttgtgcaaaccctttcaggagttgccagtaaggtacgccactatgtcgaa
ttgctggaaggcaccaacacgcagttgttggatacgcgcaaaaccttacccggcctgcgt
tcagctctgaaatacgcggtactttgcggcggcggagcgaatcaccgtctggggctttct
gatgccttcctgatcaaagaaaaccatattattgcctccggctcagtgcgccaggcggtc
gaaaaagcgtcctggctgcacccggatgcgccagtagaagtcgaagtagagaatctggaa
gaacttgatgaagccctgaaagcaggagccgatatcatcatgctggataacttcgaaaca
gaacagatgcgcgaagccgtcaaacgcaccaacggcaaggcgctactggaagtgtctggc
aacgtcactgacaaaacactgcgtgaatttgccgaaacgggcgtggactttatctccgtc
ggtgcgctaactaaacacgtacaagcactcgacctttcaatgcgttttcgctaa
              
                            

Download fasta file
RegulonDB