RegulonDB RegulonDB 10.9: Gene Sequence
rnt gene sequence


Size: 648        A: 151  T: 146  G: 165  C: 186

Fasta

 

>rnt E. coli K12. Version NC_000913.3 GI:556503834
atgtccgataacgctcaacttaccggtctgtgcgaccgttttcgtggtttttatcctgtt
gtgatcgatgttgaaacagccggatttaacgccaaaaccgatgcgctgcttgagattgcc
gccatcaccctgaaaatggatgaacaaggctggctgatgccggacaccacattacatttc
cacgtcgaaccatttgtcggcgcaaatttgcaaccagaagccctcgccttcaacggcatt
gacccgaacgatcccgatcgcggcgcggtcagcgaatacgaggcgctgcacgaaattttt
aaagttgtacgtaaaggtattaaagcgagcggctgtaaccgcgccattatggtggcgcac
aatgccaattttgatcacagctttatgatggccgccgcagaacgcgcctcactgaaacgt
aacccgttccaccctttcgccacttttgacactgctgcactggccgggctggcactcgga
caaaccgtattgtcaaaggcttgccagaccgctggcatggacttcgacagcacccaggcg
cactccgcgctgtacgacaccgaacgcactgctgtgctgttttgtgaaatcgtcaaccgc
tggaaacgtctgggaggctggccgctatctgccgccgaagaggtgtaa
              
                            

Download fasta file
RegulonDB