RegulonDB RegulonDB 10.9: Gene Sequence
lhr gene sequence


Size: 4617        A: 969  T: 1021  G: 1344  C: 1283

Fasta

 

>lhr E. coli K12. Version NC_000913.3 GI:556503834
atggcagataatccagacccttcatcgctcctgccggacgtgttttcaccggcgacccgc
gactggtttcttcgcgcctttaaacagccgaccgctgtccagccgcaaacctggcatgtg
gcggcgcgaagcgaacatgcgctggtgattgcaccgaccggctccgggaaaacgctggca
gcatttctctacgccctcgatcggctcttccgcgaaggcggcgaagatacccgcgaggcg
cataagcgtaaaacctcacgcatcctctatatttcaccgataaaagccctgggcaccgac
gttcagcgcaacttgcagatcccgttgaagggtattgccgatgaacggcggcggcgcggc
gaaacggaagtcaatcttcgcgtagggatccgtactggcgatacgcctgcacaggaacgc
agcaaactcacccgtaatccgccggatattctgatcaccacacccgaatcactctatctg
atgctgacctcccgcgcgcgcgaaacgctacgcggcgtcgaaacggtaattattgatgaa
gtccacgcggtagcgggcagtaaacgtggtgcgcatctggcgttaagtctggagcggctc
gatgcgctgctccacacctcagcacagcgaattggcctttctgccactgtgcgctcagcc
agcgatgtggcagcatttcttggtggcgatcgcccggttacggtagtcaacccgcccgca
atgcgccatccgcagatacgaattgtcgtaccggtcgccaatatggatgatgtctcatcg
gtcgccagcggcaccggcgaagacagccatgccggccgggaaggctccatctggccatat
attgaaacgggtatccttgatgaagtgttgcgccatcgctcgaccattgtctttactaat
tcgcgggggctggcggaaaaactgacggcacgattaaatgagctttacgccgcacgctta
cagcgttccccgtctatcgccgttgatgcggcccatttcgagtcgacctccggcgcaacc
tctaaccgtgtacaaagtagcgacgtttttattgcccgctcacaccacggctccgtctct
aaagaacaacgagcaatcaccgaacaggcgctgaaatcgggtgaattacgctgcgtggtc
gcaacctccagtcttgaactggggattgatatgggcgcggtggatctggtgattcaggtg
gcaacgccgctttctgttgccagtgggttacaacgcattggtcgcgccggacatcaggtt
ggcggtgtatctaaagggctgtttttcccccgtacccggcgtgatttagtcgattccgca
gtcattgtagagtgtatgttcgcaggcaggctggaaaacctgacaccaccgcataatcct
ctcgacgtccttgcgcagcaaaccgttgccgccgcggcgatggatgcattacaggtagac
gaatggtactcccgcgtacgccgtgccgcaccgtggaaagatctgccaagacgtgttttt
gacgccacgctggatatgctttccgggcgctatccctctggcgatttttctgcttttcgc
cccaaactggtctggaacagggagaccgggatattgaccgcccgacctggcgctcaattg
ttggcggttaccagcggcggcaccattccggatcgtggcatgtatagcgtgttattaccc
gaaggtgaagaaaaggccggttcgcggcgggtgggtgaactggatgaggagatggtatat
gagtcgcgggtgaacgacattatcactctcggcgctacctcatggcggatccagcaaatc
acccgcgatcaggtgattgtgactcctgctccgggtcgttctgcccggctccccttctgg
cgtggtgaaggtaacggacgtccggctgaattaggcgagatgatcggcgattttcttcat
ttgctggcggatggcgcgttcttttccgggactattcccccgtggctggcagaagaaaat
acgatcgccaatattcaggggttgattgaggagcagcgcaacgcgacgggcatcgttccg
gggagtcgccatctggtcctcgaacggtgccgtgatgaaattggtgactggcgtattatt
ttgcactctccctatggaagacgggtgcatgaaccctgggcggtggcgattgccgggcga
atacatgcgctatggggcgctgacgcgtcggtggtcgccagtgatgacggcattgttgca
cgtattcctgacaccgatggtaaattgcccgatgccgcgatttttttgtttgaaccagaa
aagttgctgcaaattgtccgcgaggcggtaggcagctcggcacttttcgccgcccgtttt
cgcgaatgcgccgcgcgggcattattaatgccggggcgcactccgggccatcgcaccccg
ctttggcaacaacggctgcgcgccagtcagttgctggaaatcgctcagggatatccggat
tttccggtcattctcgaaaccctacgcgaatgtctgcaagatgtttatgatcttcccgca
ctggaacgtttgatgcgtcgcctgaacggtggcgaaattcaaatatccgatgtaacgacc
actacgccctcgcctttcgccacaagtttattgttcggctatgtcgcggaatttatgtac
cagagcgacgccccgctggcagagcgccgggcatccgtactgtcgctggacagcgagtta
ctgcgcaatctactcggacaggtcgatccgggggaattactcgacccgcaggtcattcgc
caggtggaagaagagttgcaacgactggctcctggcagaagagcgaaaggtgaagaagga
ttgttcgacctgctgcgcgaactggggccaatgaccgttgaagacctggcgcaacggcat
acaggcagcagtgaagaggttgcgtcgtatctggaaaatcttcttgcagtaaaacgaatc
ttcccagcgatgattagcggacaggagcgtcttgcctgtatggatgatgccgccaggctg
cgtgatgccctcggcgtacgactaccagagtcattgccagagatttatttacatagagtc
agttacccgcttcgcgacctctttctgcgctatctccgggctcatgctctggtcacggct
gaacaactggctcatgagtttagtctcggtattgccattgtcgaagagcagcttcagcaa
ctgcgtgaacagggtctggtgatgaatctgcaacaagacatctgggtgagcgatgaagta
tttcgtcgtctgcgtttgcgctcgctgcaagccgccagagaagcgacgcgtcccgttgca
gccacgacctatgcgcgattgctgctggaacgtcagggcgtattacccgccaccgatggt
agcccggcgctctttgcctcaacatcgccaggcgtttatgagggcgtagatggcgtgatg
cgggtgatcgaacagcttgccggagtcggtttacccgcctcactctgggaaagccagatc
ctgcctgcccgcgtacgcgactattcgtcagaaatgctcgatgaattactggcaaccggt
gcggttatctggtcggggcaaaaaaaactgggtgaagatgacggcctggtggcactgcat
ctacaggaatatgctgcagaatcgttcactcccgccgaagcggatcaggcgaatcgttcg
gcgctgcaacaagcgatagtcgctgttctggctgacggaggagcctggtttgcacaacaa
atcagccaacggatacgcgacaaaatcggcgaatcggttgatctctctgccctgcaagag
gcgttatgggcgctggtctggcaaggcgtcatcaccagcgacatttgggcaccgttacgc
gccctcacccgcagcagttccaacgcacgcacctcaactcgccgcagtcaccgggctcgt
cgtggacgtcctgtctatgcgcaacccgtctcgccgcgggtatcttacaacacaccaaat
ctggctggacgctggtcgttattgcaggtggagccactaaacgataccgaaaggatgctg
gcgctggcggaaaatatgctcgaccgctacggcatcatcagtcgtcaggcggtgatagcc
gaaaatatccctggcgggtttccatcgatgcaaacgctttgtcgaagtatggaagactcc
gggcgaattatgcgaggtcgttttgtagaaggtctgggtggcgcgcaattcgctgaacgt
ctgactattgaccgattgcgcgatctggcgacacaagccacgcaaacgcgccactataca
ccagtggcgctctctgccaacgatccggctaatgtgtggggaaatcttctgccctggcct
gcacatccggcaacgctggttccaacgcgtcgggcgggtgcgctggtggtcgtttctggc
ggcaaattgttactctatctggcgcaaggtggcaaaaaaatgctggtctggcaggaaaaa
gaggaattactcgccccagaggttttccacgcgctgactaccgcactgcgtcgcgaacca
cggctgcgctttacgctaacagaagtgaatgatctaccggtccggcaaacgccgatgttt
acgctgctgcgtgaggcgggattttcaagttcgccacaagggctggattggggatag
              
                            

Download fasta file
RegulonDB