RegulonDB RegulonDB 10.9: Gene Sequence
pepT gene sequence


Size: 1227        A: 324  T: 291  G: 352  C: 260

Fasta

 

>pepT E. coli K12. Version NC_000913.3 GI:556503834
atggataaactacttgagcgatttttgaactacgtgtctctggatacccaatcaaaagca
ggggtgagacaggttcccagcacggaaggccaatggaagttattgcatctgctgaaagag
cagctcgaagagatggggcttatcaatgtgaccttaagtgagaagggcactttgatggcg
acgttaccggctaacgtccctggcgatatcccggcgattggctttatttctcatgtggat
acctcaccggattgcagcggcaaaaatgtgaatccgcaaattgttgaaaactatcgcggt
ggcgatattgcgctgggtatcggcgatgaagttttatcaccggttatgttcccggtgctg
catcagctactgggtcagacgctgattaccaccgatggtaaaaccttgttaggtgccgat
gacaaagcaggtattgcagaaatcatgaccgcgctggcggtattgcaacagaaaaaaatt
ccgcatggtgatattcgcgtcgcctttaccccggatgaagaagtgggcaaaggggcgaaa
cattttgatgttgacgccttcgatgcccgctgggcttacactgttgatggtggtggcgta
ggcgaactggagtttgaaaacttcaacgccgcgtcggtcaatatcaaaattgtcggtaac
aatgttcatccgggcacggcgaaaggagtgatggtaaatgcgctgtcgctggcggcacgt
attcatgcggaagttccggcggatgaaagcccggaaatgacagaaggctatgaaggtttc
tatcatctggcgagcatgaaaggcaccgttgaacgggccgatatgcactacatcatccgt
gatttcgaccgtaaacagtttgaagcgcgtaaacgtaaaatgatggagatcgccaaaaaa
gtgggcaaagggttacatcctgattgctacattgaactggtgattgaagacagttactac
aatatgcgcgagaaagtggttgagcatccgcatattctcgatatcgcccagcaggcgatg
cgcgattgcgatattgaaccggaactgaaaccgatccgcggtggtaccgacggcgcgcag
ttgtcgtttatgggattaccgtgcccgaacctgttcactggcggttacaactatcatggt
aagcatgagtttgtgactctggaaggtatggaaaaagcggtgcaggtgatcgtccgtatt
gccgagttaacggcgcaacggaagtaa
              
                            

Download fasta file
RegulonDB