RegulonDB RegulonDB 11.1: Gene Sequence
hypF gene sequence


Size: 2253        A: 441  T: 514  G: 704  C: 594

Fasta

 

>hypF E. coli K12. Version NC_000913.3 GI:556503834
atggcaaaaaacacatcttgcggtgtccaactgcgtattcgtggcaaagtgcagggcgtc
ggttttcgtccgtttgtctggcagctggcacagcaattaaatcttcacggcgatgtctgt
aatgacggcgatggcgtagaagtccggctgcgggaagacccggaaacgtttcttgttcaa
ttgtatcagcactgcccgccgctggcgcgtattgatagcgtcgagcgtgagccgtttatc
tggtcacaactgcccaccgagttcactatacgccagagcacaggcggcaccatgaatacg
caaattgttcccgatgccgctacttgccctgcttgccttgccgaaatgaataccccaggc
gaacggcgttatcgttatccgtttatcaactgtacccactgcggcccgcgtttcaccatt
attcgcgccatgccttacgaccgcccgtttaccgtgatggcggcgtttccgctatgtccg
gcctgtgacaaagagtaccgtgacccgctcgatcgtcgcttccacgcccagccggtggcc
tgcccggagtgtggcccgcatcttgaatgggtaagtcatggtgaacatgcggaacaagag
gcggcattacaggcagctatcgcacagttaaaaatgggcaaaattgtcgccatcaaaggg
attggcggatttcatcttgcctgcgatgcacgtaacagtaacgcggtggcgacacttcgg
gcgcgcaaacatcgcccggcgaaaccgctggcggtcatgttgccagtggctgacggttta
ccagacgctgcgcgccagttgcttaccacgcccgccgcgccgattgtgctggtggataaa
aaatacgttcctgagctttgtgatgatatcgcccctgaccttaacgaagtcggggtaatg
ttgcctgcgaacccgctccagcatttgctgttacaggaactgcaatgcccgctggtgatg
acctccggcaacctgagcggtaaaccaccagctatcagcaacgaacaggcgctggcggat
ttgcagggcattgccgacggattcttgatacataaccgcgacatcgtgcagcggatggat
gattcggtggtgcgcgaaagcggcgaaatgctgcgccgttcgcgggggtatgtgccggat
gcgctggctttgcctccgggctttaaaaatgttccgcctgtgctgtgtctcggcgcggat
ctgaaaaataccttctgcctggtgcgcggtgaacaagcggtgttgagtcagcatctgggc
gatttaagtgacgatggcatccagatgcagtggcgcgaagcgttacgcctgatgcaaaac
atctacgattttaccccgcaatacgttgtgcatgacgcgcatccgggctatgtctccagc
cagtgggcgcgtgaaatgaatctgccgacgcaaacggtactgcatcatcatgcccatgca
gcggcgtgtctggcagagcatcagtggccgctggatggcggtgatgtcattgctttgacg
ctcgacggtatcggtatgggggagaacggcgctttgtggggcggcgagtgcctgcgggtg
aactatcgcgaatgtgagcacctgggcggcttgcctgcagtggcgcttccgggtggcgat
ttggcagcgaagcagccgtggcgaaacctgctggcgcagtgcctgcgctttgtgccggag
tggcagaattactctgaaacagcaagtgtgcaacagcaaaactggagcgtgctggcgcgg
gccattgagcgtggaattaacgcgccgctggcgtcatcgtgtgggcgttttttcgatgca
gtggcggcggcactgggctgtgcgccagccacgttaagttatgaaggtgaagcggcttgt
gctctggaggcgctcgcagcctcatgccacggagtgacgcatccggtgacaatgccgcgg
gtggacaatcaactggatctcgccactttctggcagcagtggctgaactggcaggcaccg
gttaatcaacgcgcgtgggcgtttcatgatgcgctggcgcagggttttgccgcgttgatg
cgtgagcaggccacgatgcgtggtatcactacgctggtatttagcggcggggttattcat
aaccgtttgctgcgtgcacgtctggcgcattatctcgctgatttcacattgctctttcca
cagagtttaccggcgggtgatggcggtttgtctctggggcagggggttattgctgcggcg
cgttggttagcgggtgaagtccagaacggataa
              
                            

Download fasta file
RegulonDB