RegulonDB RegulonDB 10.9: Gene Sequence
yaaJ gene sequence


Size: 1431        A: 259  T: 409  G: 394  C: 369

Fasta

 

>yaaJ E. coli K12. Version NC_000913.3 GI:556503834
atgccagattttttctccttcattaacagcgtcctttggggatcggtaatgatttacctg
ctcttcggcgcaggttgttggttcacttttcgcaccggatttgtgcagtttcgctacatc
cgccagtttggcaaaagtcttaaaaatagcattcatccacagccaggcggtttaacctca
tttcagtcattgtgtaccagtcttgcggcgcgcgtgggtagcggcaacctggccggcgtt
gcgctggctattaccgccggtggacctggagccgtcttttggatgtgggttgccgcgttt
atcggcatggcgacctcgtttgccgaatgttctctggcacaactttataaagaacgtgac
gtcaatgggcagtttcgtggcggaccggcatggtatatggcgcgcgggctggggatgcgc
tggatgggcgttctgttcgccgtctttttgctcatcgcctatggcataattttcagcgga
gttcaagcgaacgccgttgcccgcgccctgagtttttcttttgattttcccccgctggtg
acaggcattattctcgctgtctttactctgctggcaatcactcgcggtcttcatggcgtc
gcccggctcatgcagggctttgtcccgttgatggcgataatctgggtactgaccagcctg
gtaatttgcgtaatgaatatcgggcaacttccccacgtcatttggtctatttttgagagt
gcttttggctggcaggaagcggcaggcggcgcggcgggatataccttaagccaggcgatt
actaacggttttcagcgcagtatgttttccaatgaggcgggaatgggttcgacgccaaac
gcggcagcggcagcggcgtcctggcctccgcatccggcagcgcaagggattgtccagatg
attggcatttttatcgacaccctggtcatctgtacggcaagcgccatgctgatattactg
gcgggtaacggcacaacctacatgccgctggaaggtattcagcttatccagaaggcgatg
cgggtgctaatgggttcctggggtgctgagtttgttacccttgtggttattctgtttgcc
ttcagctccatcgttgccaactacatttatgccgaaaacaatctcttctttttacgcctg
aacaaccctaaagcgatctggtgtttgcggatctgcaccttcgcaacggtcatcggcggc
accttgctaagccttccgctgatgtggcaactggcagatatcataatggcctgcatggct
attaccaatttgaccgccattttactgctctcgcctgtggttcataccattgccagtgat
tatctacgccagcgtaaactcggcgtgcgcccggtgtttgatccattgcgttatccggat
atcggtcgccagctttctccggacgcgtgggatgatgtttcgcaggagtaa
              
                            

Download fasta file
RegulonDB