RegulonDB RegulonDB 10.9: Gene Sequence
caiD gene sequence


Size: 786        A: 184  T: 177  G: 234  C: 191

Fasta

 

>caiD E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaatcattacatctgacccgcaatggatcaattctggaaattacccttgatcgt
ccaaaagcgaatgctattgatgcaaaaaccagctttgaaatgggcgaagtatttctaaat
ttccgtgacgatccgcaattacgtgtcgccattattaccggtgccggagagaagttcttt
tccgcgggctgggatttaaaagcggcagcagaaggcgaagcaccggatgctgactttggt
ccgggtggttttgcgggattaaccgaaattttcaatctcgacaaaccggttatcgcagct
gtgaacggctatgcctttggcggcggctttgaactggcgctggcggcagattttattgtt
tgtgccgataacgccagcttcgccctgccggaagccaaactgggcatcgttcctgacagc
ggcggtgtgctgcgtctgccgaagatcctgccgcctgccatcgtcaatgaaatggtgatg
accggcagacgaatgggcgcagaagaggcgctgcgttgggggatagtcaaccgcgtggtt
agccaggcggaactgatggataacgcccgcgaactggctcagcagctggttaacagcgcc
ccgctggcgattgcggcgctgaaagagatctaccgcaccaccagcgaaatgccggtagaa
gaagcgtatcgctatattcgcagcggcgtgttgaaacactatccatcggttctgcattcg
gaagatgccattgaagggccgctggcgtttgccgagaagcgcgatccggtgtggaaagga
cgttaa
              
                            

Download fasta file
RegulonDB