RegulonDB RegulonDB 10.9: Gene Sequence
yaaU gene sequence


Size: 1332        A: 240  T: 382  G: 392  C: 318

Fasta

 

>yaaU E. coli K12. Version NC_000913.3 GI:556503834
atgcaaccgtccagaaactttgacgatctcaaattctcctctattcaccgccgcattttg
ctgtggggaagcggtggtccgtttctggatggttatgtactggtaatgattggcgtggcg
ctggagcaactgacgccggcgctgaaactggacgctgactggattggcttgctgggcgcg
ggaacgctcgccgggctgttcgttggcacatcgctgtttggttatatttccgataaagtc
ggacggcgcaaaatgttcctcattgatatcatcgccatcggcgtgatatcggtggcgacg
atgtttgtttcatcccccgtcgaactgttggtgatgcgggtacttatcggcattgtcatc
ggtgcagattatcccatcgccacctcaatgatcaccgagttctccagtacccgtcagcgg
gcgttttccatcagctttattgccgcgatgtggtatgtcggcgcgacctgtgccgatctg
gtcggctactggctttatgatgtggaaggcggctggcgctggatgctgggtagcgcggcg
atcccctgtttgttgattttgattggtcgattcgaactgcctgaatctccccgctggtta
ttacgcaaagggcgagtaaaagagtgcgaagagatgatgatcaaactgtttggcgaaccg
gtggctttcgatgaagagcagccgcagcaaacccgttttcgcgatctgtttaatcgccgc
cattttccttttgttctgtttgttgccgccatctggacctgccaggtgatcccaatgttc
gccatttacacctttggcccgcaaatcgttggtttgttgggattgggggttggcaaaaac
gcggcactagggaatgtggtgattagcctgttctttatgctcggctgtattccgccgatg
ctgtggttaaacactgccggacggcgtccattgttgattggcagctttgccatgatgacg
ctggcgctggcggttttggggctaatcccggatatggggatctggctggtagtgatggcc
tttgcggtgtatgcctttttctctggcgggccgggtaatttgcagtggctctatcctaat
gaactcttcccgacagatatccgcgcctctgccgtgggcgtgattatgtccttaagtcgt
attggcaccattgtttcgacctgggcactaccgatctttatcaataattacggtatcagt
aacacgatgctaatgggggcgggtatctcgctgtttggcttgttgatttccgtagcgttt
gccccggagactcgagggatgtcactggcgcagaccagcaatatgacgatccgcgggcag
agaatggggtaa
              
                            

Download fasta file
RegulonDB