RegulonDB RegulonDB 10.9: Gene Sequence
kefF gene sequence


Size: 531        A: 114  T: 127  G: 147  C: 143

Fasta

 

>kefF E. coli K12. Version NC_000913.3 GI:556503834
atgattcttataatttatgcgcatccgtatccgcatcattcccatgcgaataaacggatg
cttgaacaggcaaggacgctggaaggcgtcgaaattcgctctctttatcaactctatcct
gacttcaatatcgatattgccgccgagcaggaggcgctgtctcgcgccgatctgatcgtc
tggcagcatccgatgcagtggtacagcattcctccgctcctcaaactttggatcgataaa
gttttctcccacggctgggcttacggtcatggcggcacggcgctgcatggcaaacatttg
ctgtgggcggtgacgaccggcggcggggaaagccattttgaaattggtgcgcatccgggc
tttgatgtgctgtcgcagccgctacaggcgacggcaatctactgcgggctgaactggctg
ccaccgtttgccatgcactgcacctttatttgtgacgacgaaaccctcgaagggcaggcg
cgtcactataagcaacgtctgctggaatggcaggaggcccatcatggatag
              
                            

Download fasta file
RegulonDB