RegulonDB RegulonDB 10.9: Gene Sequence
djlA gene sequence


Size: 816        A: 192  T: 194  G: 251  C: 179

Fasta

 

>djlA E. coli K12. Version NC_000913.3 GI:556503834
atgcagtattggggaaaaatcattggcgtggccgtggccttactgatgggcggcggcttt
tggggcgtagtgttaggcctgttaattggccatatgtttgataaagcccgtagccgtaaa
atggcgtggttcgccaaccagcgtgagcgtcaggcgctgttttttgccaccacttttgaa
gtgatggggcatttaaccaaatccaaaggtcgcgtcacggaggctgatattcatatcgcc
agccagttgatggaccgaatgaatcttcatggcgcttcccgtactgcggcgcaaaatgcg
ttccgggtgggaaaatcagacaattacccgctgcgcgaaaagatgcgccagtttcgcagt
gtctgctttggtcgttttgacttaattcgtatgtttctggagatccagattcaggcggcg
tttgctgatggttcactgcacccgaatgaacgggcggtgctgtatgtcattgcagaagaa
ttagggatctcccgcgctcagtttgaccagtttttgcgcatgatgcagggcggtgcacag
tttggcggcggttatcagcagcaaactggcggtggtaactggcagcaagcgcagcgtggc
ccaacgctggaagatgcctgtaatgtgctgggcgtgaagccgacggatgatgcgaccacc
atcaaacgtgcctaccgtaagctgatgagtgaacaccatcccgataagctggtggcgaaa
ggtttgccgcctgagatgatggagatggcgaagcagaaagcgcaggaaattcagcaggca
tatgagctgataaagcagcagaaagggtttaaatga
              
                            

Download fasta file
RegulonDB