RegulonDB RegulonDB 10.9: Gene Sequence
thiP gene sequence


Size: 1611        A: 255  T: 415  G: 495  C: 446

Fasta

 

>thiP E. coli K12. Version NC_000913.3 GI:556503834
atggcaacgcgccgtcagccgttaattcccggctggttaattccaggtgtaagcgccacc
acgctggtggtagcggttgcgctggcggcgtttctcgccctgtggtggaacgcgccgcag
gatgactgggtggcagtctggcaggacagctatctgtggcatgtggtgcgcttctccttc
tggcaggcgtttctctcggcactgctctctgtcatacccgcgatattcctcgcccgcgcg
ctctatcgcaggcgctttccgggtcggctggcgctgttgcgtctgtgtgcaatgaccttg
atcctcccggtgttggtcgctgttttcggcattcttagcgtctatggtcgccagggctgg
ctggcaacactctgccaatcgctcggtctggagtggaccttttcgccctacggcctgcaa
ggtattttgctggcccatgtgttttttaatctgccgatggcgagccgcttattactccag
gcactggaaaacatccccggcgaacagcgtcaacttgccgcccagcttgggatgcgtagc
tggcattttttccgcttcgtcgaatggccgtggttacggcgacaaatcccgccggttgct
gcgcttatctttatgctctgtttcgccagcttcgccaccgtgctatcgctggggggcggt
ccgcaggcgaccactatcgagctggcaatctatcaggcgctgagttacgactacgatcct
gcccgcgcggcaatgctggcgctgctccagatggtgtgctgcctcgggctggtgctgttg
agtcagcgattgagtaaggccattgcgcccggcaccacgctgctgcaaggctggcgcgac
ccggacgatcgtctgcatagccgcatttgcgacacggtgttaattgtgctggcgctgctg
ctgttgctgccaccgttactggcggtgatcgtcgatggggtaaatcgccagttgccggaa
gtgctggcacaaccggtgctgtggcaggcgctgtggacctcgttgcgtattgcgctggcg
gcaggtgtattgtgcgtagtgctgaccatgatgctgctatggagcagtcgcgaactgcgg
gcgcggcagaaaatgctggcgggtcaggtgctggagatgagcggcatgttgatcctcgcc
atgccggggattgtgctggctaccggcttctttttactgctcaacaacactatcggcctg
ccacaatctgctgacggcattgtgattttcaccaatgcgttaatggcgatcccttatgcg
ctgaaagtgctggaaaacccgatgcgcgatatcaccgcccgctacagcatgttatgtcag
tcgctggggattgaaggctggtcacgcttaaaagtggtggagctgcgcgccctgaaacgt
ccactggcgcaggcgctggcctttgcatgcgtgctgtcgattggtgattttggcgtggtg
gcgttgttcggtaacgatgatttccgcaccctgccgttttatctctaccagcaaattggc
tcctatcgcagccaggacggtgcggtcaccgcgttaattctgctgctgctctgttttctg
ctgtttaccgtgattgaaaaactaccggggcgaaatgttaaaactgactga
              
                            

Download fasta file
RegulonDB