RegulonDB RegulonDB 10.9: Gene Sequence
thiB gene sequence


Size: 984        A: 251  T: 209  G: 265  C: 259

Fasta

 

>thiB E. coli K12. Version NC_000913.3 GI:556503834
gtgttaaaaaaatgtctgcccctgctgttgctgtgcacagcgcccgttttcgctaaaccc
gttctgactgtttatacctacgattccttcgccgccgactgggggcctggtccggtggtt
aaaaaagcctttgaagccgactgtaattgcgaactgaaactggtggcgctggaagatggc
gtttcgcttctcaaccgtctacggatggaaggcaaaaacagtaaagccgatgtggtgctg
gggctggataacaacctgttagacgccgccagtaaaaccggactgtttgccaaaagcggt
gtggcagcggatgccgttaacgttcccggcggctggaataatgacactttcgtaccgttt
gattatggctacttcgccttcgtttatgacaagaacaaactgaaaaacccgccacaaagc
ctgaaagaactggttgagagcgatcaaaactggcgggtgatttatcaggatccgcgcacc
agtacaccggggctgggtctgttgctatggatgcaaaaagtctatggcgatgacgcccca
caagcctggcagaaactggcgaagaaaacggtcacggtcaccaaaggctggagcgaagcc
tacggcctgtttttaaaaggtgaaagcgatctggtactgagttacaccacctctccggct
tatcacattctcgaagagaagaaagataactacgccgccgcgaacttcagcgaaggtcac
tatctgcaagtggaagtcgccgcccgcaccgctgccagcaagcagccggagctggcgcaa
aaattcctccagtttatggtttctccggctttccagaatgcgatcccaaccggcaactgg
atgtatccggtggcaaacgtcacgctgcctgccggttttgaaaaattgaccaaacccgca
accacgttggagttcacgccagccgaagtggcggcacaacgtcaggcatggattagcgaa
tggcaacgcgccgtcagccgttaa
              
                            

Download fasta file
RegulonDB