RegulonDB RegulonDB 10.9: Gene Sequence
leuD gene sequence


Size: 606        A: 150  T: 144  G: 162  C: 150

Fasta

 

>leuD E. coli K12. Version NC_000913.3 GI:556503834
atggcagagaaatttatcaaacacacaggcctggtggttccgctggatgccgccaatgtc
gataccgatgcaatcatcccgaaacagtttttgcagaaagtgacccgtacgggttttggc
gcgcatctgtttaacgactggcgttttctggatgaaaaaggccaacagccaaacccggac
ttcgtgctgaacttcccgcagtatcagggcgcttccattttgctggcacgagaaaacttc
ggctgtggctcttcgcgtgagcacgcgccctgggcattgaccgactacggttttaaagtg
gtgattgcgccgagttttgctgacatcttctacggcaatagctttaacaaccagctgctg
ccggtgaaattaagcgatgcagaagtggacgaactgtttgcgctggtgaaagctaatccg
gggatccatttcgacgtggatctggaagcgcaagaggtgaaagcgggagagaaaacctat
cgctttaccatcgatgccttccgccgccactgcatgatgaacggtctggacagtattggg
cttaccttgcagcacgacgacgccattgccgcttatgaagcaaaacaacctgcgtttatg
aattaa
              
                            

Download fasta file
RegulonDB