RegulonDB RegulonDB 10.9: Gene Sequence
leuC gene sequence


Size: 1401        A: 346  T: 274  G: 395  C: 386

Fasta

 

>leuC E. coli K12. Version NC_000913.3 GI:556503834
atggctaagacgttatacgaaaaattgttcgacgctcacgttgtgtacgaagccgaaaac
gaaaccccactgttatatatcgaccgccacctggtgcatgaagtgacctcaccgcaggcg
ttcgatggtctgcgcgcccacggtcgcccggtacgtcagccgggcaaaaccttcgctacc
atggatcacaacgtctctacccagaccaaagacattaatgcctgcggtgaaatggcgcgt
atccagatgcaggaactgatcaaaaactgcaaagaatttggcgtcgaactgtatgacctg
aatcacccgtatcaggggatcgtccacgtaatggggccggaacagggcgtcaccttgccg
gggatgaccattgtctgcggcgactcgcataccgccacccacggcgcgtttggcgcactg
gcctttggtatcggcacttccgaagttgaacacgtactggcaacgcaaaccctgaaacag
ggccgcgcaaaaaccatgaaaattgaagtccagggcaaagccgcgccgggcattaccgca
aaagatatcgtgctggcaattatcggtaaaaccggtagcgcaggcggcaccgggcatgtg
gtggagttttgcggcgaagcaatccgtgatttaagcatggaaggtcgtatgaccctgtgc
aatatggcaatcgaaatgggcgcaaaagccggtctggttgcaccggacgaaaccaccttt
aactatgtcaaaggccgtctgcatgcgccgaaaggcaaagatttcgacgacgccgttgcc
tactggaaaaccctgcaaaccgacgaaggcgcaactttcgataccgttgtcactctgcaa
gcagaagaaatttcaccgcaggtcacctggggcaccaatcccggccaggtgatttccgtg
aacgacaatattcccgatccggcttcgtttgccgatccggttgaacgcgcgtcggcagaa
aaagcgctggcctatatggggctgaaaccgggtattccgctgaccgaagtggctatcgac
aaagtgtttatcggttcctgtaccaactcgcgcattgaagatttacgcgcggcagcggag
atcgccaaagggcgaaaagtcgcgccaggcgtgcaggcactggtggttcccggctctggc
ccggtaaaagcccaggcggaagcggaaggtctggataaaatctttattgaagccggtttt
gaatggcgcttgcctggctgctcaatgtgtctggcgatgaacaacgaccgtctgaatccg
ggcgaacgttgtgcctccaccagcaaccgtaactttgaaggccgccaggggcgcggcggg
cgcacgcatctggtcagcccggcaatggctgccgctgctgctgtgaccggacatttcgcc
gacattcgcaacattaaataa
              
                            

Download fasta file
RegulonDB