RegulonDB RegulonDB 10.8: Gene Sequence
ybiA gene sequence


Size: 483        A: 136  T: 104  G: 123  C: 120

Fasta

 

>ybiA E. coli K12. Version NC_000913.3 GI:556503834
atgcccgttcgagcacaaaggatccaacacgtcatgcaagacaccatcataaatttctac
agcaccagcgatgactacggtgatttttctaactttgccgcctggcccatcaaggttgac
gggaaaacctggcctacctcagaacactattttcaggcacaaaaattccttgatgaaaaa
taccgcgaagagatccgtcgggtttcttcccctatggtcgccgcacgcatggggcgcgat
cgttctaagcctctgcgtaaaaactgggagtcggtcaaagaacaggtgatgcgaaaagca
cttcgcgctaaattcgaacagcatgcagaactgcgtgcgctcttgctggcaaccgcgccc
gcaaaactggttgagcatacggaaaacgatgcttactggggagacggtggtcatggtaag
ggcaagaatcgactgggctaccttttaatggagttgcgcgaacaattggctatagagaag
taa
              
                            

Download fasta file
RegulonDB