RegulonDB RegulonDB 10.9: Gene Sequence
ybiB gene sequence


Size: 963        A: 226  T: 201  G: 290  C: 246

Fasta

 

>ybiB E. coli K12. Version NC_000913.3 GI:556503834
atggactatcgcaaaatcattaaagagatcgggcgcgggaaaaaccacgcgcgcgattta
gaccgggatactgcgcgcggtctgtatgctcatatgctcaatggtgaagtccctgacctt
gagttgggcggcgtattgattgcgctgcgtatcaaaggagaaggggaagcagagatgctc
ggcttttacgaagccatgcaaaatcacaccatcaagctgacgccgccagcaggcaagccg
atgccgattgtcatccccagttacaacggcgcgcgtaaacaggccaacctgacgccgttg
ttggcgattctcctgcacaaactcggttttcctgtggtggttcacggggttagcgaagat
ccaacccgcgtgctgactgaaaccatttttgaattgatgggtattacgccaacgttgcac
ggcgggcaggcgcaggcgaagctcgacgaacatcaaccggtgtttatgccagtcggcgcg
ttttgcccgccgctggaaaaacaactggcgatgcgctggcggatgggcgtgcgtaacagt
gcacataccctggcgaaactggcgacgccatttgccgaaggtgaggcgctgcgtctttcc
agcgtttcgcatccggaatacattggacgcgtcgcgaagttctttagcgatatcggcggg
cgggcgctactaatgcatggtactgaaggtgaagtgtatgctaatccgcagcgctgcccg
cagatcaatctcattgaccgtgaagggatgcgggtgctgtatgaaaaacaggacactgct
ggtagcgagttactgccacaagcaaaagatccggaaaccacggcgcagtggattgagcgt
tgccttgctggcagcgaaccgattcccgaatcgctgaaaatccagatggcttgctgcctg
gtggctacgggtgaagcggcaactatcagcgacggcctggcgcgcgttaatcaggcattt
taa
              
                            

Download fasta file
RegulonDB