RegulonDB RegulonDB 10.9: Gene Sequence
hcxB gene sequence


Size: 1086        A: 236  T: 246  G: 324  C: 280

Fasta

 

>hcxB E. coli K12. Version NC_000913.3 GI:556503834
atggaaagtggtcatcgctttgatgctcagacgctgcacagttttattcaggctgtattt
cgtcagatgggtagcgaggaacaagaagcgaaattagttgccgatcatttaatcgcggca
aacctggcagggcatgattcacatggtattggcatgatcccaagctatgtacgctcctgg
agtcaggggcacctgcaaattaaccatcatgccaaaaccgttaaagaggcgggggcggcg
gtcacgctcgatggcgatcgcgcatttggtcaggtcgcggcacatgaagcgatggcgctg
gggattgagaaagcgcatcagcacggtattgccgccgtggcgctacataactcgcatcat
atcggccgtatcggttactgggcggagcagtgtgcagcggcggggtttgtctctatccac
tttgttagcgtggtcggtattccaatggtcgcgccgttccacggtcgcgacagccgcttt
ggcaccaatccgttctgtgtggttttccctcgtaaagataatttcccgctgttgcttgat
tacgccaccagcgccattgcatttggcaaaacccgcgtcgcctggcataaaggcgtcccc
gtgccgccaggttgcctgattgacgttaacggcgtgccgacgaccaatccggcggtaatg
caggagtcgccgttgggttcgctgttgacctttgccgaacataaaggctacgcccttgca
gcgatgtgtgaaattcttggcggggcgctttccggcggtaaaacgacgcatcaggaaacg
ttacaaaccagtcccgatgccattcttaactgcatgaccactatcatcatcaacccggaa
ctcttcggcgcgccggattgtaacgcgcagaccgaagcctttgccgagtgggtgaaagcc
tcgccgcatgatgatgataagccgattttgctaccgggcgagtgggaagtgaacacgcgt
cgcgaacggcagaagcaggggattccactggatgcgggaagctggcaggccatttgtgat
gcagcgcggcagattggtatgccggaagagacgttgcaggctttctgtcagcagttagcc
agctaa
              
                            

Download fasta file
RegulonDB