RegulonDB RegulonDB 10.9: Gene Sequence
ybeD gene sequence


Size: 264        A: 80  T: 62  G: 58  C: 64

Fasta

 

>ybeD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaccaaacttaacgaactgcttgaattccctactccttttacttacaaagttatg
gggcaggcgttacctgagctggttgatcaggtggttgaagtggtacagcgccatgcgcca
ggtgactacaccccaacggtaaaaccaagcagcaaaggcaactaccactcggtatctatc
actatcaacgccactcatatcgagcaggttgaaacactgtatgaagaactgggcaaaatc
gatattgtccgcatggttctgtaa
              
                            

Download fasta file
RegulonDB