RegulonDB RegulonDB 10.9: Gene Sequence
moaA gene sequence


Size: 990        A: 226  T: 228  G: 262  C: 274

Fasta

 

>moaA E. coli K12. Version NC_000913.3 GI:556503834
atggcttcacaactgactgatgcatttgcgcgtaagttttactacttgcgcctgtcgatt
accgatgtgtgtaactttcgttgcacctactgcctgccggatggctacaaaccgagcggc
gtcaccaataaaggctttcttaccgtcgatgaaattcgccgggttacgcgcgccttcgcc
agactgggcaccgaaaaagtgcgcctgacaggaggagagccgtctttacgccgcgacttt
accgatatcatcgccgctgtgcgggaaaacgacgctatccgccagattgcggtcacaacc
aatggttaccgtctggaacgcgatgtggcgagctggcgcgatgcgggacttactggcatt
aacgtcagtgtcgacagtctggacgcccgccagtttcacgctattaccgggcaggataaa
ttcaaccaggtcatggcagggattgatgctgcatttgaggccggttttgagaaggtcaaa
gtcaataccgtgctgatgcgtgatgttaatcatcaccagctcgacacctttctgaactgg
atccagcatcgccctatccagctgcgtttcatcgaactgatggaaacgggcgagggcagc
gagctcttccgtaagcatcacatctctggtcaggttctgcgtgacgagctactgcgtcgc
ggctggatccaccaattacgtcaacgcagcgacggtcccgcgcaagtcttttgccatcca
gattacgccggagagattggccttatcatgccgtatgaaaaagacttctgcgccacttgc
aaccgcctgcgcgtttcctccattggtaaactccatctctgcctgtttggtgaaggcggc
gttaacctgcgcgatctgctggaagacgatacccagcaacaggcgctggaagcgcgtatt
tcagcggcgctgcgggagaagaaacagacccatttcctgcatcaaaacaacaccggtatt
acgcaaaacttatcgtacattggcggctaa
              
                            

Download fasta file
RegulonDB