RegulonDB RegulonDB 10.10: Gene Sequence
moaB gene sequence


Size: 513        A: 118  T: 128  G: 143  C: 124

Fasta

 

>moaB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggtaagcactgaatttatcccgacccgtattgctattcttacggtttctaat
cgtcgcggtgaagaagacgatacctccggtcactatctgcgcgattcggcgcaagaagcg
ggccatcacgttgtcgataaagccattgtgaaagaaaaccgctacgctattcgcgctcag
gtatctgcgtggatcgccagcgacgatgtacaagtggtattgattacgggtggtactggc
ctgacggaaggtgatcaggctcccgaagcattgctgccgttgttcgaccgtgaagttgaa
ggttttggtgaagtgttccggatgttgtcgtttgaagagattggcacttccacgttgcaa
tctcgtgcggtagcgggcgtcgccaacaaaacgctgattttcgccatgccgggttcgacc
aaagcgtgccgtaccgcatgggaaaatatcatcgcgccgcagctggatgcccgtacgcgt
ccgtgtaatttccatccacatttgaagaaataa
              
                            

Download fasta file
RegulonDB