RegulonDB RegulonDB 10.10: Gene Sequence
moaD gene sequence


Size: 246        A: 52  T: 57  G: 76  C: 61

Fasta

 

>moaD E. coli K12. Version NC_000913.3 GI:556503834
atgattaaagttctttttttcgcccaggtgcgcgagttggtgggaacagatgcaaccgaa
gtggctgcggatttcccaactgttgaagcgttacgccagcacatggctgcgcagagcgat
cgctgggcgctggcgctggaagatggcaaattactggctgccgtcaaccagacgctggtg
agttttgaccatccgctgactgacggcgacgaagtagctttcttcccgccggtaaccgga
ggttaa
              
                            

Download fasta file
RegulonDB