RegulonDB RegulonDB 10.9: Gene Sequence
moaE gene sequence


Size: 453        A: 108  T: 88  G: 146  C: 111

Fasta

 

>moaE E. coli K12. Version NC_000913.3 GI:556503834
atggcagaaaccaaaattgttgttggtccgcagccgttcagcgtaggagaagagtacccg
tggctggcggagcgtgacgaagacggtgcggtagtcacctttactggtaaggtgcgcaac
cataacctgggcgacagcgtcaacgcattaaccctcgaacactatccggggatgactgaa
aaagcactggcagaaattgttgatgaagcgcgtaaccgctggccgctggggcgcgtcact
gtgattcaccgcatcggggaattatggccgggcgatgaaatcgtttttgtcggtgtcacc
agtgcgcatcgcagcagtgcgtttgaagccgggcagtttattatggattatctcaaaacc
cgcgcaccgttctggaagcgcgaagccacgccggaaggcgaccgctgggttgaagctcgg
gagagcgatcagcaggcggcaaaacgctggtag
              
                            

Download fasta file
RegulonDB