RegulonDB RegulonDB 10.10: Gene Sequence
sseA gene sequence


Size: 846        A: 198  T: 198  G: 252  C: 198

Fasta

 

>sseA E. coli K12. Version NC_000913.3 GI:556503834
atgtccacgacatggtttgtaggagccgactggctcgccgaacatattgatgacccggaa
attcagattatcgatgcccgcatggcgtcgcctggacaggaggatcgtaacgttgctcag
gagtatctgaatggacatattcccggcgcagtgttttttgatatcgaagcgctttctgat
cacacttccccgcttccgcacatgctgccgcgcccggaaacgttcgccgtggcgatgcgt
gaattaggcgttaaccaggataagcacctgattgtctatgacgaaggtaatcttttctca
gccccacgagcatggtggatgctgcgcacctttggtgtagagaaagtgtcgattctgggg
ggtggacttgcaggctggcagcgcgatgatctgctgttagaagaaggtgcagtagagctg
ccggaaggagagtttaacgccgcgtttaatcctgaagccgtggtgaaagtaaccgatgta
ttattggcaagccatgaaaatacggcgcaaattattgatgcccgcccggctgcacgtttt
aacgcagaagttgatgaacctcgcccaggtttacgtcgcggacatattcccggagcactg
aatgttccgtggacggaactggtgcgcgaaggcgaactaaaaacgaccgatgaactggat
gcgatattttttggtcgcggcgtcagctacgacaaaccaattatcgtcagctgcggctct
ggtgtaacggcagccgtggttttgttagcactcgcgacgctggatgtgccaaacgtgaaa
ctgtacgacggcgcatggagtgaatggggcgcgcgggcagatttaccggttgagccagtg
aaataa
              
                            

Download fasta file
RegulonDB