RegulonDB RegulonDB 10.10: Gene Sequence
sseB gene sequence


Size: 777        A: 224  T: 187  G: 197  C: 169

Fasta

 

>sseB E. coli K12. Version NC_000913.3 GI:556503834
atgtccgaaacaaaaaacgaacttgaagacctgctggaaaaagcagcaactgaaccggcg
caccgcccggcctttttccgtactctactggaatccaccgtctgggtgcctggtacggcg
gcgcagggcgaggctgtggttgaagatagcgcgcttgatttacagcactgggaaaaagaa
gacggcaccagcgtcattccttttttcacctcgttagaagcacttcaacaggcggttgaa
gacgaacaggcatttgtcgtaatgcccgttcgcacgctgtttgagatgacacttggcgaa
acgctcttccttaatgccaaactgccaaccggtaaagaatttatgccgcgtgaaatcagt
ttgttgattggtgaagagggaaatccgctgagcagccaggaaatcctggaaggcggtgaa
tcgctgatattatcggaagtcgcagagccgccagcacaaatgattgattcactcaccacc
ttatttaaaaccattaagccggtgaagcgtgcttttatttgttcaattaaagagaacgaa
gaggcacagcctaatttacttattggcattgaagccgatggtgatatcgaagaaattatt
caggcgacgggaagtgtagcgaccgatacattacctggcgatgaaccaatcgatatttgt
caggtgaaaaaaggggaaaaaggaattagccactttattaccgaacatattgcgccattc
tatgaacgtcgctggggtggttttttgcgtgactttaaacagaatcggataatctaa
              
                            

Download fasta file
RegulonDB