RegulonDB RegulonDB 10.9: Gene Sequence
kch gene sequence


Size: 1254        A: 336  T: 387  G: 265  C: 266

Fasta

 

>kch E. coli K12. Version NC_000913.3 GI:556503834
gtgagtcactgggctacattcaaacaaacagcaacaaatttatgggtgacccttcggcac
gacattctcgcgctggccgtctttttaaatggattgcttatttttaaaacaatctatggt
atgtcggtcaatttgcttgatattttccatatcaaagcattttcagagttggatctctcc
ttgctggcaaacgccccactctttatgctcggcgtctttcttgtcctgaactccattggc
ttactgttccgggcaaagctcgcatgggcaatcagtatcattttgttgttgatagcgcta
atttacaccctgcatttttatccctggctgaaatttagtattggattttgcatttttacg
ctggtgtttttgctgatactgcgcaaagacttctcccacagtagcgccgcagccgggaca
atttttgcatttattagtttcacgacattactgttttactcaacctacggtgcgctttat
ttaagcgaaggttttaatccgcgaatagaaagtttgatgaccgcgttctatttttcgata
gaaaccatgtcaaccgtcggctatggcgatattgtccctgtttctgaatcagcacgattg
ttcactatttcggtcattatttccggcattaccgtttttgccacatctatgacctcaatt
tttggtccgcttatccgcgggggattcaacaaacttgtaaaaggaaacaatcatacaatg
catcgtaaagatcattttattgtttgcggacattcgattctcgccatcaatacgatcctg
caactgaatcaacgcggacaaaacgtaacggttatcagcaacttgcctgaagatgatatc
aagcaacttgagcaacgcttaggcgataatgctgatgttatccccggtgacagtaatgac
agttctgtattaaagaaagcgggaatcgatcgttgccgggccattctggcgctgagtgat
aacgatgcagataacgcgtttgttgtactctcggcaaaagatatgagcagtgatgtcaaa
acagttctcgccgtcagtgatagcaaaaacctgaataagattaagatggtacatccggat
atcattctctcaccgcaactgtttggcagcgaaattctggcgcgagttttaaatggtgaa
gagattaataatgatatgctcgtttcaatgttgttgaactcaggtcatggtattttcagc
gataacgatgaactagaaacgaaagctgacagtaaagaatcggcgcaaaaatag
              
                            

Download fasta file
RegulonDB