RegulonDB RegulonDB 10.9: Gene Sequence
clsA gene sequence


Size: 1461        A: 319  T: 387  G: 397  C: 358

Fasta

 

>clsA E. coli K12. Version NC_000913.3 GI:556503834
atgacaaccgtttatacgttggtgagttggttggccattctgggatactggttgctcatt
gcaggcgtaactttacgcattctaatgaaacgacgcgcagttccctccgcgatggcctgg
ctgttgattatttacattctgccgttagtcggaattattgcctatcttgccgttggcgag
ctccatttaggcaaacgccgcgctgagcgcgccagagcgatgtggccttccaccgcaaaa
tggcttaacgaccttaaagcctgtaagcatatcttcgccgaagaaaatagcagtgtcgct
gcgccattattcaagctttgcgagcgtcgtcaggggatcgctggggtcaaagggaatcag
ctacaactgatgaccgagtcagatgatgtgatgcaggcgttaatccgcgacatccagctc
gcgcgccataatattgagatggtgttttatatctggcagcccggcggcatggcggaccag
gtggctgaatcattaatggcggctgcgcgacgcggcattcattgccgattgatgctcgac
tccgccgggagtgtggcttttttccgcagcccgtggcccgagctaatgcgtaatgccggt
attgaagtggtcgaagccttaaaggtcaatctgatgcgtgtgtttttacgccgtatggac
ctgcgccaacatcgcaagatgatcatgatcgataattacatcgcgtacaccggcagcatg
aatatggtcgatcctcgctacttcaaacaagatgcgggcgtagggcaatggattgatctg
atggcgcgtatggaaggccctatcgccaccgcgatggggattatttattcctgcgactgg
gagattgaaaccggaaaacgtattctgccgccaccaccagatgtcaatattatgccgttt
gaacaggccagcggtcacaccattcacacaattgcttctggccccggctttccggaagat
ctcattcaccaggcattattgactgcggcttattcggcgcgtgaatatttgatcatgacc
acgccctactttgtgccaagcgatgatttacttcatgcgatttgcacggcggcgcagcgc
ggggtggatgtcagtattatccttccgcgaaaaaatgactcgatgctggtcggctgggcc
agtcgcgcattctttacggaactgctggctgctggggttaaaatttatcagtttgaaggc
gggttactgcataccaagagcgtgctggtcgatggcgaactaagtctggttggcacagtt
aaccttgatatgcgtagtctgtggctaaatttcgagattaccctggcaatcgacgataaa
ggttttggtgctgacctcgccgccgttcaggacgattatatttcgcgttcacgtctgctc
gatgcccgtttatggctaaaacgtccattatggcaacgtgtcgccgagcgactgttttac
ttcttcagtccgttgctgtaa
              
                            

Download fasta file
RegulonDB