RegulonDB RegulonDB 10.10: Gene Sequence
gdx gene sequence


Size: 318        A: 59  T: 90  G: 99  C: 70

Fasta

 

>gdx E. coli K12. Version NC_000913.3 GI:556503834
atgtcctggattatcttagttattgctggtctgctggaagtggtatgggccgttggcctg
aaatatacccacggctttagtcgtttgacgccgagtgttattactgtgacggcgatgatt
gtcagtatggcgctacttgcctgggcgatgaaatcgttaccagtagggacggcttatgcc
gtgtggacgggtattggcgcagtcggcgcggccataaccggcattgtgctgctcggtgag
tccgctaacccgatgcgcctggcgagtctggcgttaatcgtattggggattattggtctg
aaactcagcactcactaa
              
                            

Download fasta file
RegulonDB